Halo: Reach Forum
This topic has moved here: Subject: Do you know you suck, and hate it?
  • Subject: Do you know you suck, and hate it?
Subject: Do you know you suck, and hate it?

Because I do.

By the way, just to get it out of the way:
inb4lolreach
inb4lolbk
inb4urbad
inb4inb4

Anyways, I'm barely passable at Halo, and it makes me sad/mad.

The highest my overall k/d has ever been in Reach is 1.23, and I only got there by power weapon whoring, playing super conservatively, and being hyper alert at all times while playing. Needless to say, it's no fun.

Since I've stopped caring as much, my k/d has only fallen, but I've had more fun playing. Bottom line for me is that I think I have less natural ability than the average gamer who has logged as many games as I have, and that just sucks.

My motto? "It sucks to suck."

  • 11.07.2011 10:07 PM PDT
  • gamertag: [none]
  • user homepage:

I only notice I suck some times, and that's only when the other team is better than me. I'm obviously not the best but that doesn't happen to often.

  • 11.07.2011 10:10 PM PDT

WAY TO GO!!!!!!!!!!!!!!!!!!!!!!

  • 11.07.2011 10:10 PM PDT

No. I'm not bad, but I'm not an MLG pro. I'm good and I'm fine with it even though it's nothing special.

  • 11.07.2011 10:11 PM PDT
  • gamertag: [none]
  • user homepage:

Main | Connection | Youtube Channel


50s: | Slayer | Doubles | Lone Wolves | SWAT | Snipers |

OMG OP CAN'T INB4!!! STOP BREAKING THE RULES!

  • 11.07.2011 10:11 PM PDT

Posted by: AcidThe Wraith
I only notice I suck some times, and that's only when the other team is better than me. I'm obviously not the best but that doesn't happen to often.


Well, you're about 2x as good as me. I'd be pretty pleased if I could play as well as you, myself :p

  • 11.07.2011 10:14 PM PDT

Posted by: Darkside Eric
So basically... Waypoint is pro-vanilla?

Posted by: Sentox6
Waypoint isn't pro-anything so much as they're just anti-intelligence.

I consider myself fairly bad. You get used to it after a while.

  • 11.07.2011 10:15 PM PDT
  • gamertag: [none]
  • user homepage:


Posted by: UnsaidOcean187
Posted by: AcidThe Wraith
I only notice I suck some times, and that's only when the other team is better than me. I'm obviously not the best but that doesn't happen to often.


Well, you're about 2x as good as me. I'd be pretty pleased if I could play as well as you, myself :p


Don't worry man, I believe in you..maybe some day =P

  • 11.07.2011 10:17 PM PDT

Posted by: nicksta14
I consider myself fairly bad. You get used to it after a while.


Yeah, I suppose that's the thing - I really, really want to be good. I should probably just give up on that.

  • 11.07.2011 10:17 PM PDT
  • gamertag: [none]
  • user homepage:


Posted by: UnsaidOcean187
Posted by: nicksta14
I consider myself fairly bad. You get used to it after a while.


Yeah, I suppose that's the thing - I really, really want to be good. I should probably just give up on that.


Naw man, you just need practice. You should add me, we can play Octagon. I need some one to play it with..

  • 11.07.2011 10:21 PM PDT

Posted by: Darkside Eric
So basically... Waypoint is pro-vanilla?

Posted by: Sentox6
Waypoint isn't pro-anything so much as they're just anti-intelligence.


Posted by: UnsaidOcean187


First and foremost, you need a good team. Work on making good friends, and the rest will come with time.

  • 11.07.2011 10:21 PM PDT


Posted by: nicksta14
First and foremost, you need a good team. Work on making good friends, and the rest will come with time.


Yeah, it probably doesn't help that I've played EVERY game as a random. I've always wondered how different things would be with a team...

  • 11.07.2011 10:24 PM PDT
  •  | 
  • Veteran Legendary Member

The 343 forums suck. They're full of retarded kids and mods who got butthurt in the B.net forums for being told that they're bad.


Posted by: nicksta14

Posted by: UnsaidOcean187


First and foremost, you need a good team. Work on making good friends, and the rest will come with time.


No, the first step is acceptance of your troubles, which the OP has done. Bravo, OP.

The SECOND step is to get a good team and to learn how to work with them. THEN comes practice.

  • 11.07.2011 10:26 PM PDT

I SUCK BUT I DON'T SUCK WITHOUT HAVING MY PERSONNEL MOTTOCYCLE
LIKE A BOSS////////////////////////////////\\\\\\\\\\\\\\\\\\\\\\\\\ \\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/ \\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\/\/\/\/\/\/\/\/\/\/\/\/ \/\/\/\/\/\/\/\/\/\//\/\\/\/\/\/\/\/\\/\\/\\/\/\/\/\/\/\/\/\/ \/\/\/\\/\//\/\GGCCTTTAAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAG CTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGGGATTCTTC TTTCGAGGCTAGGCTAGGCTAGCTGACTAGCTAGCTAGCTAGCTAGCTATTTTATAAAGGC TAGCTATGCTATAGCTAGCTA





















THAT IS MY DNA SEQUENCE FOR BEING A M U TH A F U CKING GOOD PLAYER

  • 11.07.2011 10:27 PM PDT

Posted by: AngryBrute1
Oh yeah, since somebody does not believe what YOU believe; that makes us vapid...
I cannot grasp that what you call "Something happened to nothing, and that nothing became something, and it was smaller than than a period."

Posted by: AcidThe Wraith
I only notice I suck some times, and that's only when the other team is better than me. I'm obviously not the best but that doesn't happen to often.
same here; I am better some days than others, and recently every other game I play, I lose, without fail.

  • 11.07.2011 10:28 PM PDT

You arent going to find a good team if you arent good...

Work on individual skill and people will notice that individual skill.

  • 11.07.2011 10:47 PM PDT

WEEEEEEEEEEEEEEEEEEEELLLLLLLLL

  • 11.07.2011 10:50 PM PDT
  • gamertag: [none]
  • user homepage:

i'm alright :) the only time i suck is when i go against a team i know is skill wise better than me and my team. most time i dont really go up against other players like that

  • 11.07.2011 10:52 PM PDT
  • gamertag: Xyrelt
  • user homepage:

Play it, love it, rate it.

Who cares? The only thing that truely matters is that you have fun playing. :)

  • 11.07.2011 10:55 PM PDT

i don't care about K/D's i just want to have fun :)

  • 11.07.2011 10:55 PM PDT